معلومة

كيف تكون الأحماض الأمينية متعادلة عند درجة الحموضة الفسيولوجية؟

كيف تكون الأحماض الأمينية متعادلة عند درجة الحموضة الفسيولوجية؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

الأحماض الأمينية ذات السلاسل الجانبية غير المؤينة هي zwitterions عندما تكون في درجة الحموضة الفسيولوجية ، الرقم الهيدروجيني 7.4. هذا ما يقوله كتابي. لكني لا أفهم لماذا. يكون Pka لمجموعة الكربوكسيل حوالي 3 و pKa لمجموعة أمينية حوالي 9. لذا يجب أن تكون النقطة الكهربية حول (9 + 3) / 2 = 6 للحمض الأميني بدون سلسلة جانبية متأينة. عند درجة الحموضة 7.4 ستكون سالبة قليلاً ، أليس كذلك؟

أيضا ما هو بالضبط الحمض الأميني الأساسي؟ هل هذا حمض أميني له قيمة PI تزيد عن 7؟

شكرا لك.


أنت محق ، معظم الأحماض الأمينية تحتوي على pI حوالي 6 ، لذا فهي سلبية قليلاً عند الرقم الهيدروجيني 7.

تعتمد النقطة الكهربية على مجموعات الأحماض الأمينية والكربوكسيلية ومجموعات السلسلة الجانبية. على سبيل المثال يحتوي اللايسين على مجموعة أمينية على السلسلة الجانبية ، لذلك فهو يحتوي على pI 9.74.


إذا كان الحمض الأميني يحتوي على مجموعتين أمينيتين ومجموعة كربوكسيل واحدة فقط (مثل الأرجينين والليسين) ، فعندئذ تكون مشحونة إيجابياً (++ مقابل -) عند درجة الحموضة المحايدة. من ناحية أخرى ، إذا كانت الأحماض الأمينية تحتوي على مجموعتين من الكربوكسيل ومجموعة أمينية واحدة فقط (مثل حمض الجلوتاميك وحمض الأسبارتيك) ، يتم شحنها سالبًا عند الرقم الهيدروجيني 7 (- مقابل +). أنت غير محق في أن المجموعات محايدة حقًا. يتم شحن مجموعة الكربوكسيل سلبًا في محلول أعلى بكثير من pKa لمجموعة الكربوكسيل (وهو الرقم الهيدروجيني 2.48 للأرجينين). نفس الشيء ينطبق على المجموعات الأمينية (pKb عند درجة الحموضة 11.5 للأرجينين). لذلك ، عند الرقم الهيدروجيني 9.5 ، تكون نسبة المجموعة الأمينية موجبة الشحنة إلى المجموعة الأمينية المحايدة 100: 1 (عند pKb ستكون 50:50). عند درجة حموضة 4.48 ، ستكون مجموعة الكربوكسيل من الأرجينين 1: 100 سالبة الشحنة ، مقابل محايدة. لذلك ، عند الرقم الهيدروجيني 7 ، تكون كل مجموعة الكربوكسيل مشحونة سالبًا (COO-) وجميع المجموعات الأمينية (2 منها) مشحونة بالكامل (NH3 +). صافي الشحنة هو زائد 1 ، في حالة الأرجينين عند pH7.


عند درجة الحموضة 7.4 ، توجد مجموعة الكربوكسيل في الغالب على أنها COO-، في حين أن المجموعة الأمينية موجودة مثل NH3+. لذلك عندما يحتوي الجزيء على كلا المجموعتين ، مثل الحمض الأميني ، يكون الجزيء ككل متعادلًا. نظرًا لأنه Zwitterion (متساوٍ + و- شحنات) ، يمكن للهيدروجين أيضًا التقليب بين مجموعة amino و carboxyl. جعل الجزيء محايدًا حقًا لأن كلا المجموعتين غير مشحونة.

يحتوي الحمض الأميني الأساسي على مجموعة أساسية مثل المجموعة الأمينية (أرجينين) على سلسلته الجانبية.


نعم من الناحية الفنية ، فإن معظم الأحماض الأمينية ستكون سالبة الشحنة عند درجة الحموضة الفسيولوجية. لكن علينا أن نفهم ما يعنيه ذلك. لنأخذ الألانين كمثال. يمكن أن يكون أي جزيء ألانين فردي غير مشحون أو يحتوي على عدد صحيح من الشحنة الصافية - إما أن يكون بروتونيًا أو لا. لن تجد أبدًا جزيء ألانين "مشحون جزئيًا". ومع ذلك ، إذا كان لديك مجموعة من جزيئات الألانين في درجة الحموضة الفسيولوجية للمحلول ، فلن تتصرف جميعها بنفس الطريقة تمامًا في نفس الوقت بالضبط. قد يكون لجزيء واحد طرف N بروتوني بينما يحتوي جزيء آخر على طرف N منزوع البروتونات. في درجة الحموضة الفسيولوجية ، يتم إزالة الطرف C إلى حد كبير تمامًا ، لذلك علينا فقط الانتباه إلى الطرف N. يمكننا استخدام معادلة Henderson-Hasselbach لمعرفة النسبة المئوية لجزيئات الألانين التي سيكون لها طرف N بروتوني (موجب الشحنة) والنسبة المئوية التي يتم نزعها. الرقم الهيدروجيني = pKa + السجل (منزوع / بروتونات). إذا استبدلنا بأرقامنا المعروفة ، فسنحصل على 7.4 = 9.5 + سجل (منزوع / بروتوني)

لذلك -2.1 = السجل (depot / prot) و 10 ^ -2.1 = depot / prot = 0.008. هذا يعني أنه من بين 1000 جزيء ألانين ، يتم نزع حوالي 8 جزيئات منها وبالتالي تكون سالبة الشحنة. 992 الأخرى هي zwitterions. لذلك لجميع المقاصد والأغراض ، يكون الألانين محايدًا في درجة الحموضة الفسيولوجية.


9.3: الأحماض الأمينية والبروتينات ودرجة الحموضة

بالإضافة إلى فحص كيفية تأثير إضافة حمض أو قاعدة قوية على محلول منظم ، يمكننا أيضًا النظر في تأثير الأس الهيدروجيني على حمض أو قاعدة معينة. هذا مهم بشكل خاص في الأنظمة البيولوجية حيث يوجد العديد من المجموعات الحمضية أو القاعدية الضعيفة التي يمكن أن تتأثر بالرقم الهيدروجيني. على سبيل المثال ، تحتوي البروتينات على حمض ضعيف و ndashCOOH و قاعدي ضعيف & ndashNH2 مجموعات. يحتوي محلول 1.0-M من حمض الكربوكسيل البسيط مثل حمض الأسيتيك على درجة حموضة قدرها

2.8 اتضح أن معظم الأحماض الكربوكسيلية تتصرف بطريقة مماثلة. إذا تعاملنا مع الأس الهيدروجيني ، على سبيل المثال ، عن طريق إضافة قاعدة قوية ، يتفاعل حمض الأسيتيك مع القاعدة لتكوين أيون أسيتات. استنادًا إلى معادلة Henderson & ndash Hasselbalch ، عندما يكون [acetate] = [acetic acid] ، يكون الرقم الهيدروجيني pH مساويًا للحمض & rsquos pKأ، وهو 4.74. مع زيادة الأس الهيدروجيني ، يجب أيضًا زيادة تركيز الأسيتات ، حتى زيادة الرقم الهيدروجيني

7 (درجة الحموضة الفسيولوجية الطبيعية تقريبًا). عند هذه النقطة ، يكون تركيز حمض الأسيتيك صغيرًا جدًا بالفعل. نسبة القاعدة إلى الحمض حوالي 200/1. وهذا يعني أنه في مجموعات الأس الهيدروجيني الفسيولوجية مثل الأحماض الكربوكسيلية يتم نزعها وتواجدها في شكل الكربوكسيل (سالب الشحنة).

على العكس من ذلك ، إذا نظرنا إلى المجموعة الأمينية (& ndashNH2) من البروتين ، إنه في الواقع الجزء الأساسي من زوج حمض-قاعدي مترافق يكون فيه الحمض هو الشكل البروتوني & ndashNH3 +. إن pKأ من مجموعة & ndashNH3 + عادةً

9. عند الرقم الهيدروجيني 9 توجد كميات متساوية من البروتونات (& ndash NH2) والأشكال غير المبرمجة (& ndashNH3 +). لذلك إذا قمنا بتغيير الرقم الهيدروجيني بإضافة حمض ، فإن تركيز & ndash NH3 + الشكل يزيد كالشكل الأساسي & ndashNH2 هو البروتونات. في درجة الحموضة

7 هناك القليل من & ndashNH2 الشكل المتبقي.

ومن المثير للاهتمام ، أن هذا يعني أن الحمض الأميني (كما هو موضح في الشكل) لا يوجد أبدًا في حالة يكون فيها كل من الأمينو (& ndashNH2) المجموعة وحمض الكربوكسيل (& ndashCO2ح) موجودة في نفس الوقت. إن الأنواع & ldquoneutral & rdquo هي في الواقع النوع الذي & ndashNH3 + / & ndashCO2 & ndash موجودة. هذا zwitterion (وهو جزيئات محايدة ذات شحنة كهربائية موجبة وسالبة في مواقع مختلفة ، من zwitter الألماني ، بمعنى & ldquobetween & rdquo) هو الشكل السائد في درجة الحموضة الفسيولوجية.

يتكون البروتين بشكل أساسي (أحيانًا فقط) من بوليمرات الأحماض الأمينية ، المعروفة باسم عديد الببتيدات. في عديد ببتيد ، فإن الأمينو (& ndashNH2) وحمض الكربوكسيل (& ndashCO2ح) مجموعات من الأحماض الأمينية مرتبطة ببعضها البعض لتكوين رابطة ببتيدية (انظر الشكل).

مجموعة الأميد الناتجة (رابطة الببتيد) ليست حمضية ولا أساسية في ظل الظروف الفسيولوجية. ومع ذلك ، فإن العديد من الأحماض الأمينية الموجودة في البروتينات لها سلاسل جانبية حمضية (حمض الأسبارتيك أو حمض الجلوتاميك) أو قاعدية (ليسين أو أرجينين أو هيستيدين). يؤثر الرقم الهيدروجيني للبيئة على توافق جزيء البروتين والتفاعلات بين هذه السلاسل الجانبية المشحونة (تسمى المطابقات الأصلية التلقائية للجزيء طي البروتين). يمكن أن تؤدي التغييرات من بيئة & ldquonormal & rdquo إلى تغييرات في بنية البروتين ، وهذا بدوره يمكن أن يغير النشاط البيولوجي. في بعض الحالات ، يتم تنظيم نشاط البروتين بواسطة درجة الحموضة البيئية. في حالات أخرى ، يمكن أن تؤدي التغييرات في الرقم الهيدروجيني إلى اختلال البروتين (أو تمسخ البروتين ، والذي يمكن أن يتسبب في الكائنات الحية في تعطيل نشاط الخلية أو الموت). على سبيل المثال ، إذا كانت هذه المجموعات متكونة من البروتونات أو منزوعة البروتونات ، يمكن أن تتغير البيئة الإلكترونية في تلك المنطقة من البروتين بشكل كبير ، مما قد يعني أن البروتين لن يغير فقط كيفية تفاعله مع الأنواع الأخرى ولكن قد يتغير شكله لتقليل الحد الأدنى. تفاعلات مثيرة للاشمئزاز أو تنتج تفاعلات جذابة جديدة. يمكن أن يكون للتغييرات الصغيرة في شكل البروتين تأثيرات عميقة على كيفية تفاعل البروتين مع الجزيئات الأخرى ، وإذا كان محفزًا ، فإن كفاءته وخصوصياته. في الواقع ، هناك حالات يتم فيها استخدام الأس الهيدروجيني البيئي لتنظيم نشاط البروتين.


تصنيف

بالإضافة إلى المجموعات الأمينية والكربوكسيلية ، تحتوي الأحماض الأمينية على سلسلة جانبية أو مجموعة R متصلة بـ & alpha-carbon. كل حمض أميني له خصائص فريدة تنشأ عن خصائص الحجم والشكل والذوبان والتأين لمجموعة R. نتيجة لذلك ، تمارس السلاسل الجانبية للأحماض الأمينية تأثيرًا عميقًا على بنية البروتينات ونشاطها البيولوجي. على الرغم من أنه يمكن تصنيف الأحماض الأمينية بطرق مختلفة ، إلا أن أحد الأساليب الشائعة هو تصنيفها وفقًا لما إذا كانت المجموعة الوظيفية على السلسلة الجانبية عند درجة الحموضة المحايدة غير قطبية أو قطبية ولكنها غير مشحونة أو سالبة الشحنة أو موجبة الشحنة. يتم إعطاء هياكل وأسماء الأحماض الأمينية العشرين ، واختصاراتها المكونة من حرف واحد وثلاثة أحرف ، وبعض ميزاتها المميزة في الجدول ( فهرس الصفحة <1> ).

الجدول ( فهرس الصفحة <1> ): الأحماض الأمينية الشائعة الموجودة في البروتينات
اسم شائع اختصار الصيغة الهيكلية (عند درجة الحموضة 6) الكتلة المولية سمة مميزة
أحماض أمينية مع مجموعة R غير قطبية
جليكاين gly (G) 75 الحمض الأميني الوحيد الذي يفتقر إلى الكربون اللولبي
ألانين علاء) 89 و [مدش]
فالين فال (الخامس) 117 حمض أميني متفرع السلسلة
ليسين ليو (L) 131 حمض أميني متفرع السلسلة
إيزولوسين إيل (أنا) 131 حمض أميني أساسي لأن معظم الحيوانات لا تستطيع تصنيع الأحماض الأمينية متفرعة السلسلة
فينيل ألانين phe (F) 165 تصنف أيضا على أنها من الأحماض الأمينية العطرية
التربتوفان trp (W) 204 تصنف أيضا على أنها من الأحماض الأمينية العطرية
ميثيونين التقى (م) 149 تعمل السلسلة الجانبية كمانح لمجموعة الميثيل
برولين الموالية (ف) 115 يحتوي على مجموعة أمين ثانوية يشار إليها باسم وحمض ألفا إيمينو
أحماض أمينية ذات مجموعة R قطبية ولكنها محايدة
سيرين سر (S) 105 وجدت في الموقع النشط للعديد من الإنزيمات
ثريونين Th (T) 119 سميت لتشابهها مع السكر الثلاثي
سيستين cys (C) 121 ينتج عن أكسدة جزيئين سيستين سيستين
تيروزين صور (ص) 181 تصنف أيضا على أنها من الأحماض الأمينية العطرية
الهليون asn (ن) 132 أميد حمض الأسبارتيك
الجلوتامين gln (س) 146 أميد حمض الجلوتاميك
الأحماض الأمينية مع مجموعة R سالبة الشحنة
حمض الأسبارتيك آسيا والمحيط الهادئ (د) 132 تتأين مجموعات الكربوكسيل عند درجة الحموضة الفسيولوجية المعروفة أيضًا باسم الأسبارتات
حمض الجلوتاميك صمغ) 146 تتأين مجموعات الكربوكسيل عند درجة الحموضة الفسيولوجية المعروفة أيضًا باسم الجلوتامات
الأحماض الأمينية مع مجموعة R موجبة الشحنة
الهيستيدين له (ح) 155 الحمض الأميني الوحيد الذي تحتوي مجموعته R على pKأ (6.0) بالقرب من درجة الحموضة الفسيولوجية
ليسين ليس (ك) 147 و [مدش]
أرجينين arg (R) 175 تقريبا قاعدة قوية مثل هيدروكسيد الصوديوم

كان الهليون أول حمض أميني تم عزله في عام 1806. تم الحصول عليه من البروتين الموجود في عصير الهليون (ومن هنا جاءت تسميته). تم تسمية الجلايسين ، وهو الحمض الأميني الرئيسي الموجود في الجيلاتين ، لمذاقه الحلو (اليونانية glykys، معنى و ldquosweet و rdquo). في بعض الحالات ، يكون الحمض الأميني الموجود في البروتين مشتقًا من أحد الأحماض الأمينية العشرين الشائعة (أحد هذه المشتقات هو هيدروكسي برولين). التعديل يحدث بعد، بعدما تم تجميع الأحماض الأمينية في بروتين.


شكوى DMCA

إذا كنت تعتقد أن المحتوى المتاح عن طريق موقع الويب (كما هو محدد في شروط الخدمة الخاصة بنا) ينتهك واحدًا أو أكثر من حقوق الطبع والنشر الخاصة بك ، فيرجى إخطارنا من خلال تقديم إشعار كتابي ("إشعار الانتهاك") يحتوي على المعلومات الموضحة أدناه إلى الوكيل المذكور أدناه. إذا اتخذ Varsity Tutors إجراءً ردًا على إشعار الانتهاك ، فسيحاول بحسن نية الاتصال بالطرف الذي جعل هذا المحتوى متاحًا عن طريق عنوان البريد الإلكتروني الأحدث ، إن وجد ، الذي قدمه هذا الطرف لمعلمي Varsity.

قد تتم إعادة توجيه إشعار الانتهاك الخاص بك إلى الطرف الذي جعل المحتوى متاحًا أو إلى جهات خارجية مثل ChillingEffects.org.

يُرجى العلم أنك ستكون مسؤولاً عن التعويضات (بما في ذلك التكاليف وأتعاب المحاماة) إذا لم تُثبت بالدليل المادي أن منتجًا أو نشاطًا ما ينتهك حقوق الطبع والنشر الخاصة بك. وبالتالي ، إذا لم تكن متأكدًا من أن المحتوى الموجود على الموقع أو المرتبط به ينتهك حقوق الطبع والنشر الخاصة بك ، فيجب أن تفكر أولاً في الاتصال بمحامٍ.

الرجاء اتباع هذه الخطوات لتقديم إشعار:

يجب عليك تضمين ما يلي:

توقيع مادي أو إلكتروني لمالك حقوق الطبع والنشر أو شخص مخول بالتصرف نيابة عنه تعريف بحقوق النشر المزعوم انتهاكها وصفًا لطبيعة وموقع المحتوى الذي تدعي أنه ينتهك حقوق الطبع والنشر الخاصة بك ، بما يكفي التفاصيل للسماح للمدرسين المختلفين بالعثور على هذا المحتوى وتحديده بشكل إيجابي ، على سبيل المثال ، نطلب رابطًا إلى السؤال المحدد (وليس فقط اسم السؤال) الذي يحتوي على المحتوى ووصف أي جزء معين من السؤال - صورة ، أو الرابط والنص وما إلى ذلك - تشير شكواك إلى اسمك وعنوانك ورقم هاتفك وعنوان بريدك الإلكتروني وبيان من جانبك: (أ) تعتقد بحسن نية أن استخدام المحتوى الذي تدعي أنه ينتهك حقوق الطبع والنشر الخاصة بك هو غير مصرح به بموجب القانون ، أو من قبل مالك حقوق الطبع والنشر أو وكيل المالك (ب) أن جميع المعلومات الواردة في إشعار الانتهاك الخاص بك دقيقة ، و (ج) تحت طائلة عقوبة الحنث باليمين ، أنك إما مالك حقوق الطبع والنشر أو شخص مخول بالتصرف نيابة عنه.

أرسل شكواك إلى وكيلنا المعين على:

تشارلز كوهن فارسيتي توتورز ذ م م
101 طريق هانلي ، جناح 300
سانت لويس ، مو 63105


أساليب

المواد

3 أحماض أمينية تحمل علامة H كانت من أميرشام. كانت الأمبيسلين ، G418 ، hygromycin B ، phleomycin ، M-199 (متوسط ​​-199) والأحماض الأمينية غير المصنفة من Sigma. مصل بقري الجنين (FBS) كان من الصناعات البيولوجية. جميع الكواشف الأخرى كانت من الصف التحليلية.

زراعة خلايا الليشمانيا

خط نسيلي من L. donovani تم استخدام 1SR في جميع التجارب 25. لضمان الطبيعة النسيلية لخط الخلية ، تم تلقيح الثقافات الجديدة باستخدام مستعمرات مفردة من البروماستيجوتيس المأخوذة من لوحات أجار M-199. نمت Promastigotes عند 26 & # x02009 & # x000b0C في M-199 مع 10 ٪ FBS.

تحليل لطخة غربية

تم إجراء تحليل اللطخة الغربية كما هو موضح سابقًا 9. باختصار ، تم حصاد 10 8 خلايا من الخلايا المشجعة ذات الطور اللوغاريتمي ، وغسلها مرتين في محلول ملحي بارد من الفوسفات (PBS) وإعادة الطرد المركزي. تم إعادة تعليق الحبيبات الناتجة في المخزن المؤقت Laemmli ثم صوتنة لمدة 2 & # x02009s لضمان تمسخ الطبيعة. تم إجراء تحضير الأغشية المستخرجة من الملح كما هو موضح في 26. تم إخضاع البروتين الكلي لـ SDS / PAGE (مختبرات بروتين بيو راد المصغرة) قبل نقله إلى غشاء النيتروسليلوز. تم حظر الأغشية باستخدام مسحوق حليب منزوع الدسم منزوع الدسم بنسبة 10٪ (وزن / حجم) في PBST (يحتوي PBS على 0.1٪ توين 20) ، المحتضنة بأجسام مضادة لـ LdAAP24 أو مضادات HA (تخفيف 1: 2000) لمدة 1 & # x02009 ساعة عند درجة حرارة الغرفة (22 & # x02009 & # x000b0C) ، وغسلها ثم احتضانها بأجسام مضادة HRP ثانوية مضادة للأرانب (بيروكسيداز الفجل) (تخفيف 1: 10000).

تحليلات التألق المناعي

من أجل التألق المناعي ، تم غسل بروماستيجوتات اللوغاريتمات المتوسطة مرتين في برنامج تلفزيوني ثم تثبيتها في 1٪ فورمالدهايد / برنامج تلفزيوني على شريحة لمدة 10 & # x02009 دقيقة قبل النفاذية بالتعرض لـ 0.2٪ Triton X-100 / PBS لمدة 10 & # x02009 دقيقة. تم تحضين الخلايا بمحلول مانع [10٪ (حجم / حجم) مسحوق حليب منزوع الدسم منزوع الدسم / PBST] لمدة 30 & # x02009 دقيقة في درجة حرارة الغرفة ، تم تحضينها باستخدام مضادات LdAAP24 أو الأجسام المضادة لـ HA (تخفيف 1: 200) لمدة 1 & # x02009h ثم احتضانها بالأجسام المضادة الفلورية المضادة للأرنب IgG متعددة النسيلة (1: 500 تخفيف Dy-light 549 Red Jackson) لمدة 1 & # x02009h في الظلام في درجة حرارة الغرفة. أخيرًا ، تم غسل الخلايا في PBST واستكمالها بـ 5 & # x02009 & # x003bcl DAPI (4 & # x02032،6-Diamidino-2-phenylindole 0.5 & # x02009 & # x003bcg / ml Fluka). تم إجراء تحليلات الإسفار باستخدام مجهر فلوري متحد البؤر (Axiovert 200M Zeiss).

الاستنساخ والتعبير

تم استنساخ LdAAP24 بتضخيم PCR (إطارات القراءة المفتوحة (ORFs) LinJ10.0760 و LinJ10.0770) ، بالإضافة إلى الإصدارات المبتورة من الناقل & # x02019s ORFs في الليشمانيا ناقلات التعبير pNUS-HnB 27 بين مواقع XhoI و KpnI. تم استنساخ الطرف N القابل للذوبان في pNUS-HnD 27 بين موقعي XhoI و KpnI. تم تمييز جميع التركيبات باستثناء & # x0039418LdAAP24 بعلامة HA في الطرف C. للتأكد من أن الهيكل المتوقع لكل بناء لم يتأثر ، نستخدم TMHMM 2.0 (http://www.cbs.dtu.dk/services/TMHMM/) 28. تظهر الاشعال لجميع التركيبات في الجدول S1. للاختيار ، نمت الخلايا في وسط بروماستيجوتيس الذي يحتوي إما على المضادات الحيوية الفلومايسين أو البلاستيدين. تم التحقق من صحة التعبير الناجح عن طريق تحليل لطخة ويسترن.

تسلسل الحمض النووي الريبي

تم إعداد مكتبات RNA-seq باستخدام طريقتين. تم تحضير مكتبات Splice Leader (SL) RNA-seq ، التي تثري نهاية mRNAs 5 & # x02032 ، كما هو موضح في مكان آخر (http://www.ncbi.nlm.nih.gov/pubmed/ ؟term = 23382545). تم تحضير مكتبات PolyA RNA-seq ، المخصبة لنهاية mRNAs 3 & # x02032 ، بطريقة مماثلة ، وتوقع أن تم استخدام أوليغو (dT) (TCCGATCTCTTTTTTV) لأول تخليق حبلا ، وهو تمهيدي سداسي عشوائي (TCCGATCTGANNNNNNN) للتخليق الثاني للحبال وتضخيم PCR تم إجراؤه باستخدام seq-primer-CT (AATGATACGGCGACCACCGACACTCTTTCCCTACGACGACGCTTCCGATCTCT) و R-primer-GA (CAAGCAGAAGACGGCATACGAGCTTCCGATCTGA). تم ترتيب تسلسل المكتبات باستخدام محلل الجينوم IIx (Illumina) في وحدة الجينوم عالية الإنتاجية في جامعة واشنطن لتوليد قراءات أحادية الطرف بطول 36 نانومتر. تم محاذاة القراءات إلى L. donovani BPK282A1 و L. infantum جينومات مرجعية JPCM5 في TriTrypDBv5.0 باستخدام Bowtie2 29.

فحوصات النقل

تم إجراء فحوصات نقل البرولين والألانين الموصوف إشعاعياً كما هو موضح في 8. L. donovani تمت زراعة البروماستيجوت على الطور اللوغاريتمي ، وغسلها مرتين في محلول إيرل بارد مثلج & # x02019s وتركيزها على 10 8 خلايا / مل. تم خلط تعليق الخلية مع خليط التفاعل (المخزن المؤقت Earl & # x02019s ، 5 & # x02009mM الجلوكوز ، 10 & # x02009mM Tris و 10 & # x02009mM succinate) عند الرقم الهيدروجيني ذي الصلة إلى الحجم النهائي 600 & # x02009 & # x003bcl. تم تحضين الخلايا مسبقًا عند 30 & # x02009 & # x000b0C لمدة 10 & # x02009min. بدأ النقل بخلط المعلق الخلوي بتركيز محدد من الأحماض الأمينية غير المسمى و 3 ركائز من الأحماض الأمينية H L في المخزن المؤقت Earl & # x02019s عند درجة الحموضة ذات الصلة. في 30 و 60 و 90 و 120 و 180 ثانية ، تمت إزالة 100 & # x02009 & # x003bcl من الخليط ووضعها مباشرة على مرشحات ميكروفايبر زجاجية 24 & # x02009mm (Whatman 1822 024). تم غسل المرشحات مرتين في المخزن المؤقت Earl & # x02019s المثلج عند درجة الحموضة ذات الصلة ونقعها في سائل التلألؤ. تم تحديد امتصاص 3 ساعات عن طريق عد التلألؤ السائل.


شرالية

جميع الأحماض الأمينية ولكن الجلايسين هي جزيئات مراوان. أي أنها موجودة في شكلين غير متماثلين نشطين بصريًا (يُطلق عليهما المتغيرات) وهما الصورتان المرآيتان لبعضهما البعض. (هذه الخاصية مشابهة من الناحية المفاهيمية للعلاقة المكانية بين اليد اليسرى واليد اليمنى). من المهم ملاحظة أن الأحماض الأمينية الموجودة في البروتينات تمتلك دائمًا التكوين L. فقط. هذا يعكس حقيقة أن الإنزيمات المسؤولة عن تخليق البروتين قد تطورت لتستخدم فقط l-enantiomers. يعكس هذا قرب العالمية ، عادة ما يتم حذف البادئة l. تم العثور على بعض الأحماض الأمينية د في الكائنات الحية الدقيقة ، وخاصة في جدران خلايا البكتيريا وفي العديد من المضادات الحيوية. ومع ذلك ، لا يتم تصنيعها في الريبوسوم.


محتويات

تحتوي جميع الأحماض الأمينية على طرف كربوكسيل (يسمى الطرف C) ونهاية أمينية (تسمى الطرف N) ، ولكنها تختلف في مجموعاتها المتبقية. الأحماض الأمينية مرتبطة ببعضها البعض بواسطة رابطة تساهمية تسمى رابطة الببتيد [6]. تحتوي الأحماض الأمينية على مجموعة كربوكسيل (COOH) ومجموعة أمينية (NH2). هيكل الأحماض الأمينية الأساسية هو:

حيث (R) هي السلسلة الجانبية الفريدة لكل حمض أميني مختلف. تشكل الأحماض الأمينية الكبيرة المنطقة الصلبة من العمود الفقري متعدد الببتيد بينما تشكل الأحماض الأمينية الصغيرة المناطق المرنة من البولي ببتيد مما يسمح للبروتين بالثني في شكله ثلاثي الأبعاد. يوجد على العمود الفقري للببتيد دوران مرن حول رابطة الببتيد وهناك ببتيد مستو صلب ناتج عن رابطة مزدوجة جزئية. هذا ما يسمح للتسلسل الأولي متعدد الببتيدات أن يطوي إلى حلزون ألفا وهو خيط واحد ملفوف. خيط بيتا عبارة عن خيطين ملفوفين في حلزون مضاد للتوازي. يتكون لب البولي ببتيد من الأحماض الأمينية الكارهة للماء مثل الفينيلانين والتيروزين والتربتوفان [8]. هذه الأحماض الأمينية الثلاثة هي أيضًا عطرية وهي أكبر الأحماض الأمينية. الأحماض الأمينية الأخرى الكارهة للماء ، ولكنها ليست عطرية ، هي: البرولين ، فالين ، إيزولوسين ، ليسين وميثيونين.

يشار إلى الأحماض الأمينية باسم مراوان بسبب ارتباط الكربون ألفا بأربع مجموعات مختلفة. يمكن أن تتواجد كواحدة من صورتين مرآتين يشار إليهما باسم ايزومر Levorotatory L و Dextrotatory D مع شكل L فقط من أيزومر الأحماض الأمينية الموجود داخل البروتينات [9].

توجد الأحماض الأمينية في المحلول عند درجة الحموضة المحايدة في الغالب على شكل أيونات ثنائية القطب ، أو zwitterions. في الشكل ثنائي القطب ، يتم بروتونات المجموعة الأمينية ، ويتم نزع مجموعة الكربوكسيل. تختلف حالة تأين الأحماض الأمينية باختلاف الرقم الهيدروجيني [10]. تشكل سلسلة من الأحماض الأمينية المرتبطة بروابط الببتيد سلسلة بولي ببتيد ، وتسمى كل وحدة من الأحماض الأمينية في الببتيد بقايا. يمكن أن يخضع اثنان من الأحماض الأمينية لتفاعل تكثيف لتشكيل ثنائي الببتيد ، مصحوبًا بفقدان جزيء الماء [11].

يتم تجميع الأحماض الأمينية الشائعة وفقًا لسلاسلها الجانبية [12]. على سبيل المثال ، حمضية ، قاعدية ، قطبية غير مشحونة ، وغير قطبية.

بالنسبة للسلاسل الجانبية الأساسية ، الأحماض الأمينية هي: Lysine (K) ، Arginine (R) و Histidine (H).

بالنسبة للسلاسل الجانبية الحمضية ، فإن الأحماض الأمينية هي: حمض الأسبارتيك (D) وحمض الجلوتاميك (E) (يتكون من إضافة بروتون إلى الأحماض الأمينية الأسبارتات والغلوتامات).

بالنسبة للسلاسل الجانبية القطبية غير المشحونة ، فإن الأحماض الأمينية هي: Asparagine (N) و Glutamine (Q) و Serine (S) و Threonine (T) و Tyrosine (Y).

البرولين (P)

يُعرف البرولين أيضًا باسم حمض أميني. والتي توجد عادة في البروتينات الحيوانية. وهو ليس ضروريًا للنظام الغذائي للإنسان لأنه يمكن تصنيعه في الجسم من حمض الجلوتاميك [13]. على عكس الأحماض الأمينية الأخرى الموجودة في التحول في عديد الببتيدات ، يمكن أن يوجد البرولين في شكل رابطة الدول المستقلة في الببتيدات. غالبًا ما يوجد البرولين في نهاية الحلزون α أو في المنعطفات أو الحلقات [14]. البرولين هو الحمض الأميني الدوري الوحيد. ويرجع ذلك إلى أن البرولين له بنية دورية غريبة عندما يشكل روابط ببتيدية ، فإنه يؤدي إلى انحناء في سلسلة الأحماض الأمينية. لذلك ، يُعرف البرولين أيضًا باسم alpha helix breaker (قاطع ألفا اللولبي الآخر هو الجلايسين) [15].

الأحماض الأمينية في الترجمة

أثناء ترجمة mRNA ، ترتبط الأحماض الأمينية بالريبوسوم لأنها تقرأ mRNA وتستخدم المعلومات المعطاة لها لإنتاج تسلسل حمض أميني معين عن طريق تكوين روابط ببتيدية بين مجموعة الكربوكسيل لحمض أميني واحد والمجموعة الأمينية الأخرى عن طريق التكثيف التفاعل. & # 160 ينتج هذا سلسلة عديد الببتيد. ترتبط الوحدة الفرعية 30S بـ mRNA أولاً ، وترتبط الوحدة الفرعية 50S بالثانية لتشكيل مجمع البادئ 70S [16].

سيستين (ج)

للحمض الأميني السيستين العديد من التطبيقات ويلعب دورًا مهمًا في بنية البروتين. هذا يرجع بشكل رئيسي إلى مجموعة الثيول. الثيول (المكون من ذرة الكبريت والهيدروجين) شديد الحساسية للأكسدة ، مما يسمح للسيستين بتكوين روابط ثاني كبريتيد مع جزيئات أخرى بما في ذلك السيستين. يسمى المنتج الناتج لاثنين من السيستين المرتبطين بالسيستين. عندما ترتبط بسيستين أخرى ، فإن رابطة ثاني كبريتيد تزيد بشكل كبير من استقرار البروتين. ومع ذلك ، نظرًا لأن هذا تفاعل أكسدة ، فهو مقصور على البروتينات خارج الخلية مع استثناءات قليلة. هذا لأن الجزء الداخلي من الخلية يتقلص بدرجة كبيرة مما يجعل رابطة ثاني كبريتيد غير مستقرة للغاية.

الأحماض الأمينية العطرية

الأحماض الأمينية العطرية هي أكبر الأحماض الأمينية وتشمل فينيل ألانين (F) ، وتيروزين (Y) وتريبتوفان (W). يمكنهم جميعًا امتصاص الضوء فوق البنفسجي ، لكن البعض يمكن أن يمتص أكثر من البعض الآخر ، يمتص التيروزين والتريبتوفان أكثر من فينيل ألانين مما يعني أن التربتوفان هو الجزيء الرئيسي الذي يمتص الضوء في البروتين. الأحماض الأمينية العطرية هي أيضًا كارهة للماء لذا فهي موجودة في قلب البروتين مما يضمن عدم قربها من الماء. لا يستطيع البشر تصنيع فينيل ألانين أو تريبتوفان ، ويمكنهم فقط صنع التيروزين من فينيل ألانين ، وهذا يعني أن الأحماض الأمينية العطرية هي عنصر حيوي في نظامنا الغذائي حيث نطلبها في بروتينات معينة ولكننا لا نصنعها بأنفسنا. تحتوي الأحماض الأمينية العطرية على حلقة عطرية [17]. يمكن أن يسبب نقص فينيل ألانين الارتباك والاكتئاب ونقص الطاقة وانخفاض اليقظة. يمكن شراؤها على شكل أقراص لتكملة أي نقص [18]. يسمى عدم القدرة على تحطيم الفينيل ألانين الزائد بيلة الفينيل كيتون. لمكافحة هذا ، يتم استخدام نظام غذائي منخفض الفينيل ألانين وتجنب محليات الأسبارتام التي تشبه فينيل ألانين ويمكن أن تتحلل لإنتاجها.


المجموعة الثانية: الأحماض الأمينية القطبية غير المشحونة

الأحماض الأمينية من المجموعة الثانية هي سيرين وسيستين وثريونين وتيروزين وأسباراجين وجلوتامين. تمتلك السلاسل الجانبية في هذه المجموعة مجموعة من المجموعات الوظيفية. ومع ذلك ، يحتوي معظمهم على ذرة واحدة على الأقل (نيتروجين أو أكسجين أو كبريت) مع أزواج إلكترونية متاحة لربط الهيدروجين بالماء والجزيئات الأخرى. التركيبات الكيميائية للأحماض الأمينية من المجموعة الثانية هي:

يحتوي اثنان من الأحماض الأمينية ، سيرين وثريونين ، على مجموعات هيدروكسيل أليفاتية (أي ذرة أكسجين مرتبطة بذرة هيدروجين ، ممثلة بـ ―OH). يمتلك التيروزين مجموعة هيدروكسيل في الحلقة العطرية ، مما يجعلها أحد مشتقات الفينول. تخضع مجموعات الهيدروكسيل في هذه الأحماض الأمينية الثلاثة لنوع مهم من تعديل ما بعد الترجمة: الفسفرة (انظر أدناه الأحماض الأمينية غير القياسية). مثل الميثيونين ، يحتوي السيستين على ذرة كبريت. على عكس ذرة الكبريت في الميثيونين ، فإن كبريت السيستين شديد التفاعل كيميائيًا (انظر أدناه أكسدة السيستين). الهليون ، المعزول أولاً من الهليون ، ويحتوي كل من الجلوتامين على الأميد ص مجموعات. يمكن أن تعمل مجموعة الكربونيل كمتقبل لرابطة الهيدروجين ، والمجموعة الأمينية (NH2) يمكن أن تعمل كمانح لسندات الهيدروجين.


Zwitterions والأحماض الأمينية

zwitterion هو جزيء له مجموعات وظيفية ، واحدة منها على الأقل لها شحنة موجبة والأخرى لها شحنة كهربائية سالبة. صافي شحنة الجزيء بأكمله هو صفر.

الأحماض الأمينية هي أشهر الأمثلة على zwitterions. تحتوي على مجموعة أمين (قاعدية) ومجموعة كربوكسيلية (حمضية). إن- NH2 المجموعة هي القاعدة الأقوى ، وبالتالي فهي تلتقط H + من المجموعة -COOH لتترك zwitterion (أي أن المجموعة الأمينية تزيل بروتونات حمض الكربوكسيل): 1

zwitterion (محايد) هو الشكل المعتاد للأحماض الأمينية الموجودة في المحلول. اعتمادًا على الرقم الهيدروجيني ، هناك نوعان آخران ، أنيون وكاتيون:

هذا يوازي سلوك حمض ثنائي البروتين:

بخطوتين تفكك يتم التحكم فيها بواسطة ثوابت حموضة ك1 وك2.

عندما يذوب حمض أميني في الماء ، يتفاعل zwitterion مع H.2جزيئات O - تعمل كحمض وقاعدة. ولكن ، على عكس البساطة مذبذب المركبات التي قد تشكل فقط نوعًا كاتيونيًا أو أنيونيًا ، فإن zwitterion له في وقت واحد كلتا الحالتين الأيونيتين.

أبسط الأحماض الأمينية هو الجلايسين (NH2-CH2-COOH) ، والتي اختصرناها بـ HGly ، أو أقصر بـ HA مع A = Gly-. تحتوي صيغته الهيكلية الموضحة أعلاه على أقصر سلسلة جانبية R = H. الأنواع الثلاثة هي:

[0] = [H.2أ +] = [ح2Gly +]: نيو هامبشاير3 + -CH2-COOH (جلسينيوم الكاتيون)
[1] = [HA] = [HGly]: نيو هامبشاير3 + -CH2-COO- (حيادي زويتيريون)
[2] = [أ -] = [Gly -]: نيو هامبشاير2-CH2-COO- (جليسينات أنيون)

ثوابت الحموضة (مقارنة بحمض الكربونيك) هي:

جليكاين: pK1 = 2.35 pK2 = 9.78
حمض الكربونيك: pK1 = 6.35 pK2 = 11.33

يظهر اعتماد الأس الهيدروجيني للأنواع الثلاثة (المختصرة ب [j] = [0] ، [1] ، [2]) في شكل كسور التأين المقابلة أي = [ي] / كتي:

منحنيات المعايرة. تعرض منحنيات المعايرة بالتحليل الحجمي ما يحدث جليكاين عند تغيير الأس الهيدروجيني عن طريق إضافة إما حمض قوي (HCl) أو قاعدة قوية (NaOH):

في الشكل الأيسر ، أربعة مقادير Cتي من الجلايسين. تتم العمليات الحسابية باستخدام الصيغ التحليلية المعروضة هنا أو في ملف pdf. النقاط الموجودة في الرسم البياني الأيمن عبارة عن حسابات رقمية بها عقيون.

سعة المخزن المؤقت وكثافة المخزن المؤقت

الوصف الرياضي لقدرات المخزن المؤقت والشدة هو نفسه للأحماض الشائعة (باستثناء الإزاحة Z = 1). توضح المخططات أدناه سعة المخزن المؤقت (منحنى المعايرة الزرقاء) جنبًا إلى جنب مع شدة المخزن المؤقت المقابلة β (أخضر) ومشتقها dβ / dpH (أحمر). يتم ذلك في حالتين: جلايسين عالي التركيز بشكل غير محدود و Cتي = 500 ملم.

النقاط الصغيرة هي أصفار dβ / dpH ، والتي تشير إلى الحد الأقصى لشدة المخزن المؤقت β وتمييز نقاط انعطاف منحنيات المعايرة. منحنى المعايرة الزرقاء في الرسم البياني الأيسر السابق هو نفسه كما في الرسم التخطيطي الأخير فيما عدا أنه يتم تبديل محوري x و y.

يتم إعطاء المزيد من الأمثلة لأحماض zwitterionic هنا.

تشير R إلى السلسلة الجانبية (جليكاين: R = H ، ألانين: R = CH3، وما إلى ذلك وهلم جرا). & # 8617


الأحماض الأمينية: المفهوم والتصنيف وردود الفعل

الأحماض الأمينية هي اللبنات الأساسية للبروتينات. من بين آلاف الأحماض الأمينية المتوفرة في الطبيعة ، تحتوي البروتينات على 20 نوعًا مختلفًا فقط من الأحماض الأمينية ، وكلها من الأحماض الأمينية L-alpha-amino. تنتج نفس الأحماض الأمينية العشرون القياسية البروتينات في جميع الخلايا الحية ، قد تكون إما فيروسات أو بكتيريا أو خميرة أو نباتية أو خلية بشرية. تتحد هذه الأحماض الأمينية العشرين في تسلسلات وأرقام مختلفة لتشكيل أنواع مختلفة من البروتينات.

يمكن حساب عدد البروتينات التي يمكن الحصول عليها من هذه الأحماض الأمينية العشرين من 20 عامليًا ، أي 20 × 19 × 18 × 17 × 16 × & # 8230 & # 8230 & # 8230 & # 8230 × 2 × 1 = 2.4 × 10 18 . يوجد في البشر وحدهم أكثر من 100000 نوع مختلف من البروتينات.

يمكن كتابة الصيغ العامة للحمض الأميني كـ & # 8216R-CH-NH2—COOH & # 8217. اعتمادًا على مجموعة & # 8216R & # 8217 الموجودة في الأحماض الأمينية ، يتم تسميتها وفقًا لذلك. تُعرف الأحماض الأمينية العشرون الموجودة في البروتينات بالأحماض الأمينية الأساسية أو القياسية. بالإضافة إلى ذلك ، توجد أيضًا بعض الأحماض الأمينية الأخرى في البروتينات مثل 4-هيدروكسي برولين ، 5-هيدروكسيليسين ، 6-IV-ميثيلليسين ، حمض جاما كاربوكسيجلوتاميك وديسموسين ، كل هذه مشتقات من الأحماض الأمينية القياسية.

تصنيف الأحماض الأمينية:

1.بناءً على التهمة:

يمكن تصنيف الأحماض الأمينية على نطاق واسع إلى ثلاث مجموعات رئيسية:

1. الأحماض الأمينية المحايدة:

تلك الأحماض الأمينية التي لا تحتوي على أي شحنة على مجموعة & # 8216R & # 8217.

يتم تصنيفها كذلك في الفئات التالية:

تلك الأحماض الأمينية التي تحتوي مجموعتها & # 8216R & # 8217 على سلسلة من ذرات الكربون — Gly ، Ala ، Ser ، Thr ، Val ، Leu ، lie ، Asn ، Gin.

تلك الأحماض الأمينية التي تحتوي مجموعتها & # 8216R & # 8217 على حلقة بنزين — Phe ، Tyr ، Trp.

تحتوي المجموعة & # 8220R & # 8221 على حلقة غير متجانسة ، أي أي من الهياكل الحلقية التي تحتوي على ذرات مختلفة - Pro، His.

(د) يحتوي على الكبريت:

تلك الأحماض الأمينية التي تحتوي على ذرة الكبريت ، Met.

تلك الأحماض الأمينية التي تحتوي على شحنة سالبة أو مجموعة حمضية - Asp، Glu.

تلك الأحماض الأمينية التي تحتوي على شحنة موجبة أو مجموعة أساسية Arg، Lys and His.

II. اعتمادا على الذوبان في الماء:

يمكن أيضًا تصنيف الأحماض الأمينية إلى فئتين مختلفتين ، اعتمادًا على قابليتها للذوبان في الماء. هم انهم-

1. أحماض أمينية كارهة للماء:

تُعرف الأحماض الأمينية غير القابلة للذوبان في الماء بالأحماض الأمينية الطاردة للماء. هم - علاء ، فال ، ليو ، كذبة ، برو ، ميت ، Phe ، Trp.

2. الأحماض الأمينية المحبة للماء:

تُعرف الأحماض الأمينية القابلة للذوبان في الماء باسم الأحماض الأمينية المحبة للماء. هم — Gly و Ser و Thr و Cys و Tyr و Asp و Asn و Glu و Gin و Lys و Arg و His.

ثالثا. اعتمادًا على متطلباتهم الغذائية:

تصنف الأحماض الأمينية إلى مجموعتين.

1. الأحماض الأمينية الأساسية:

هي تلك التي لا يمكن لجسم الإنسان تصنيعها ، وبالتالي يجب تناولها من خلال النظام الغذائي. هناك 10 أحماض أمينية أساسية. من بين هذه الأحماض الأمينية ، يُعرف الأرجينين والهيستيدين بالأحماض الأمينية شبه الأساسية.

2. الأحماض الأمينية غير الأساسية:

هذه الأحماض هي تلك التي يمكن تصنيعها في جسم الإنسان وليست مطلوبة في النظام الغذائي. وتشمل هذه gly و ala و ser و pro و tyr و cys و asp و asn و glu و gin.

تفاعلات الأحماض الأمينية:

الخصائص الفيزيائية للأحماض الأمينية:

الأحماض الأمينية لها مجموعة حمضية (مجموعة COOH) ، أي بروتون ، مانح. لديهم أيضًا مجموعة أساسية (—NH2 المجموعة) ، أي بروتون ، متقبل. يُعرف المركب القادر على التبرع بالبروتونات وقبولها وبالتالي قادر على العمل إما كحمض أو قاعدة باسم الجزيء المذبذب. تحتوي الأحماض الأمينية على الأنيونات والكاتيونات في المحلول وتسمى هذه المركبات أيونات zwitter.

2. الأس الهيدروجيني الكهروضوئي (الرقم الهيدروجيني 1):

يُعرف الرقم الهيدروجيني الذي تتساوى عنده الشحنة الموجبة على الحمض الأميني (أو أي جزيء آخر) مع الشحنات السالبة باسم الأس الهيدروجيني المتساوي الكهربي. عند هذا الرقم الهيدروجيني ، ستكون الشحنة الصافية صفراً ، وبالتالي لا تنتقل إلى القطب الموجب (الأنود) أو السالب (الكاثود) ، عند تعرضها لمجال كهربائي. عند الرقم الهيدروجيني 1 ، توجد جميع الجزيئات في شكل أيون zwitter.

الخواص الكيميائية:

1. ردود الفعل بسبب المجموعة الأمينية:

يحدد هذا الاختبار أو يكتشف الأحماض الأمينية. إذا تم تسخين الأحماض الأمينية باستخدام نينهيدرين ، فإنها تشكل مركبًا أرجوانيًا أزرق اللون ، والذي يتم قياسه بطريقة لونية.

(ب) التفاعل مع حمض النيتروز:

إنها طريقة يتم من خلالها قياس الأحماض الأمينية اعتمادًا على كمية النيتروجين المنبعثة.

(ج) التفاعل مع مركبات الكربونيل (RCHO):

تتفاعل المجموعة الأمينية في الأحماض الأمينية مع مركبات الكربونيل وتشكل قاعدة شيف & # 8217.

(د) التفاعل مع كاشف Sanger & # 8217s:

تتفاعل الأحماض الأمينية مع كاشف Sanger & # 8217s ، أي 1-فلورو -2 ، 4-ثنائي نيتروبنزين ، مكونًا مركبًا أصفر اللون. يستخدم هذا الكاشف للكشف عن الحمض الأميني الرابع في البروتينات.

كاشف Edmann & # 8217s هو فينيل أيزوثيوسيانات ، والذي يستخدم أيضًا للكشف عن الحمض الأميني N-terminal في البروتين. يشكل مشتق أرجواني اللون.

(و) التفاعل مع كلوريد دانسيل:

يشكل كلوريد Dansyl ، أي 1-ثنائي ميثيل-أمينو-نفثالين-5-سلفونيل كلوريد مشتقًا فلوريًا من الأحماض الأمينية N- الطرفية للبروتينات. هذا كاشف آخر متاح للكشف عن الحمض الأميني N- طرفي.

(ز) تكثيف اثنين من الأحماض الأمينية لتكوين ديكيتوبيبرازين:

يتفاعل نوعان من الأحماض الأمينية مع المجموعات الأمينية لكل حمض أميني والمجموعات الكربوكسيلية للحمض الأميني الآخر مكونًا ديكيتوبيبرازين.

2. رد فعل بسبب الكربوكسيل:

(a) Reaction with hydrazine:

Hydrazine is used to detect the C-terminal amino acid in proteins. It forms a complex with the amino acid by reacting with the carboxylic group.

3. Reaction due to both amino and carboxylic group:

Due to the presence of both amino (basic) and carboxylic (acid) groups in amino acids, the amino group of one amino acid reacts with the carboxylic group of another amino acid to form a peptide bond.

Polymerization of amino acids in a similar manner gives a polypeptide chain.

The bond linking two amino acids is known as a peptide bond. It is formed due to reaction between an amino group of one amino acid and carboxylic group of another amino acid.

The group forming the peptide bond is known as peptide group. It has a double bond character and hence is very rigid in nature.

Polypeptide or peptide:

A chain made up of two or more amino acids, linked by a peptide bond is known as a polypeptide or just a peptide.

Difference between a peptide and a protein:

A peptide is that which has less than 50 amino acids or whose molecular weight is less than 5000 Daltons. A protein is that which has more than 50 amino acids or whose molecular weight is more than 5000 Daltons. This differentiation is based upon the immunolog­ical property of the two units. Peptides are non-immunogenic, whereas proteins are immunogenic.

N-terminal and C-terminal of a protein:

The end of a protein or polypeptide where the amino group is free in known as N-terminal end and that amino acid whose amino group is free is known as N-terminal amino acid. Sanger’s, Edmann’s and Dansyl chloride are the reagents used to determine the N-terminal amino acids.

The end of the protein or polypeptide whose carboxylic group is free is known as C-terminal end and that amino acid whose carboxylic group is free in the protein is known as C-terminal amino acid. Hydrazine is used to detect the C-terminal amino acid. While representing a protein on paper, the N-terminal amino acid is written first (on the left) and the C-terminal amino acid is the last one (written at the right side of the paper).

Peptides of physiological importance:

It is a tripeptide made up of Glu, Cys and Gly. It is found in RBC and other tissues and functions to prevent oxidation of —SH groups of many enzymes.

(ب) Bradykinin and kallidin:

These are small polypeptides containing 9 and 10 amino acids respectively. They are formed by partial hydrolysis of plasma protein due to snake poisoning (venom). They are powerful vasodepressors and inhibitors of heart function. Others are tyrocidin, gramicidin, glucagon, insulin, oxytocin, etc.

The structure of protein can be studied under four different levels of organization, viz., primary, secondary, tertiary and quaternary.


شاهد الفيديو: علوم طبيعية العرض 5 تجربة دراسة سلوك الحمض الاميني في الوسط (كانون الثاني 2023).